View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_354 (Length: 237)
Name: NF6867A_low_354
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_354 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 41404381 - 41404160
Alignment:
| Q |
1 |
tggtttctgttcaatcgacttagaaggaagtcaaggaacacaattgcttgcgagtagagcacatgccaaaaatgactctaattgactcgtaatctatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41404381 |
tggtttctgttcaatcgacttagaaggaagtcaaggaacacaattgcttgcgagtagagcacatgccaaaaatgactctaattgactcgtaatctatcaa |
41404282 |
T |
|
| Q |
101 |
acatgtcttatagggtctgattcctactttcatacacatcatttcattgcagccacacgattgaaggtcttttgactgccaaaaccagaatctactattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
41404281 |
acatgtcttatagggtctgattcctactttcatacacatcatttcattgcagccacacgattgaaggtcttttgactgcgaataccagaatctactattt |
41404182 |
T |
|
| Q |
201 |
atagcttcaacgtaaatgtgat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41404181 |
atagcttcaacgtaaatgtgat |
41404160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University