View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_356 (Length: 237)
Name: NF6867A_low_356
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_356 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 9 - 237
Target Start/End: Complemental strand, 20489885 - 20489661
Alignment:
| Q |
9 |
gattatactaagtatgcatgtgtagttcttaaagttgtttgcactggaaaaggctactctaccattatcctttgctccattggtgggacttcatgacata |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20489885 |
gattatactaagtatgcatgtgtagttcttaaagttgtttgcactggaaaaggctactctaccattatcctttgctccattggtgggacttcatgacata |
20489786 |
T |
 |
| Q |
109 |
tgacgtaccttccttgatgatacttaaagaaaaatttgaagatttacatgacaagacattttctatctattaatattaattatactaatctatatttcta |
208 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20489785 |
tgac----cttccttgattttacttaaagaaaaatttgaagatttacatgacaagacattttctatctattaatattaattatactaatctatatttcta |
20489690 |
T |
 |
| Q |
209 |
ctattacagctaattacttgaatctgcca |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20489689 |
ctattacagctaattacttgaatctgcca |
20489661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University