View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_369 (Length: 233)
Name: NF6867A_low_369
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_369 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 44321715 - 44321514
Alignment:
| Q |
18 |
aaaataacgataagaaaatgacaagataaagggtataaatctgtccctctatgtatatagtgccagtatcaaataacacaatcagcatttatgaaatctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44321715 |
aaaataacgataagaaaatgacaagataaagggtataaatctgtccctctatgtatatagtgccagtatcaaataacacaatcagcatttatgaaatctt |
44321616 |
T |
 |
| Q |
118 |
aatactcacactgcttaataattttaagtagaatatgaaatgaattcctatccctgaagtcaaaattctaacgggtataccagtcttataaaatttgatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||| |
|
|
| T |
44321615 |
aatactcacactgcttaataattttaagtagaatatgaaatgaattcctatccctgaagtcaaaattctaacgagtatactagtcttataaaatttcatg |
44321516 |
T |
 |
| Q |
218 |
tc |
219 |
Q |
| |
|
|| |
|
|
| T |
44321515 |
tc |
44321514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University