View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_370 (Length: 232)
Name: NF6867A_low_370
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_370 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 17 - 133
Target Start/End: Complemental strand, 5954866 - 5954750
Alignment:
| Q |
17 |
atcacagatcatatgggaatttttagtgatcactggtgaaaatatatttttagttagtctggtttttagataagaaacttgtgggtattgatttgtttaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5954866 |
atcacagatcatatgggaatttttagtgatcactggtgaaaatatatttttagttagtctggtttttagttaagaaacttgtgggtattgatttgtttaa |
5954767 |
T |
 |
| Q |
117 |
gatgcttattccttaat |
133 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5954766 |
gatgcttattccttaat |
5954750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University