View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_374 (Length: 231)
Name: NF6867A_low_374
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_374 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 4 - 189
Target Start/End: Complemental strand, 179662 - 179477
Alignment:
| Q |
4 |
acgttgatatctgacattgcccctattttagcaaaatagtcagcattttgatttccttcccggagggtgtggttgagcgaaaaattctttagagaaagct |
103 |
Q |
| |
|
||||||| |||||||||||| |||| |||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
179662 |
acgttgacatctgacattgcacctagtttagccaaatagtcagcactttgatttccttcccggagggtgtggttgagcgaaaaattccttagagaaagct |
179563 |
T |
 |
| Q |
104 |
tgtctctgatgtcttggataagggctacatgaatatggaactttgagctggtggtattgatgagattaattgaaaggagagaatct |
189 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
179562 |
tgtctctgatatcttggattagggccgcatgaatatggaactttgaactggtggtagtgatgagattaattgaaaggagagaatct |
179477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University