View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_388 (Length: 230)
Name: NF6867A_low_388
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_388 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 230
Target Start/End: Original strand, 30274508 - 30274727
Alignment:
| Q |
11 |
acatcagatacgacaatgacactgacacgtaaatatcagtgataacataaaaatgactgcatattatcacatgtgttagcgttgtatctatactgttgtt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30274508 |
acattagatacgacaatgacactgacacgtaaatatcaatgataacataaaaatgactgcatattatcacatgtgttagcgttgtatctatactgttgtt |
30274607 |
T |
 |
| Q |
111 |
gtctgacactcacgccttcaatataaaacgtcgatgctacatgtgttgtaattgatttagcatatgtcatataaatggcctaccgtgacaatgacagatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30274608 |
gtctgacactcacgccttcaatataaagcgtcgatgctacatgtgttgtaattgatttagcatatgtcatataaatggcctaccgtgacaatgacagatt |
30274707 |
T |
 |
| Q |
211 |
tgtctttattaaagagaggt |
230 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
30274708 |
tgtcttcattaaagagaggt |
30274727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University