View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_417 (Length: 228)
Name: NF6867A_low_417
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_417 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 7 - 225
Target Start/End: Complemental strand, 3272419 - 3272198
Alignment:
| Q |
7 |
aaaacagaatgtaaaactcccttcaaagaaaatgctttcttttgaacaatctatctaaccacattgcttgtgaaattgctgttatatgatgtaaaaaaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272419 |
aaaacagaatgtaaaactcccttcaaagaaaatggtttcttttgaacaatctatctaaccacattgcttgtgaaattgctgttatatgatgtaaaaaaca |
3272320 |
T |
 |
| Q |
107 |
tgaaaccacactgtttgtc---nnnnnnnnnnnntttgtgttaaccctccggtttttagggaaagaggccctagcaatccggttcggttagaaggtaaat |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272319 |
tgaaaccacactgtttgtcaaaaaaaaaaaaaaaattgtgttaaccctccggtttttaggggaagaggccctagcaatccggttcggttagaaggtaaat |
3272220 |
T |
 |
| Q |
204 |
aaagtctgaccaataattattt |
225 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3272219 |
aaagtctgaccaataattattt |
3272198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University