View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_420 (Length: 228)
Name: NF6867A_low_420
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_420 |
 | |
|
| [»] scaffold0432 (3 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 9804887 - 9804675
Alignment:
| Q |
1 |
tgaagtttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactggtcgatgtcgatctcagtgaagtttcatggttcttt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9804887 |
tgaactttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactgatcgatgtcgatctcagtgaagtttcatggttcttt |
9804788 |
T |
|
| Q |
101 |
tttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgagaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9804787 |
tttctgatcgatgtcgatctcagtgatggtgcttggagagaggttggcaacagcgattgagggagaaaattgtgtttagggtttcaagagaatgagaaat |
9804688 |
T |
|
| Q |
201 |
gaggatgggagga |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9804687 |
gaggatgggagga |
9804675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 98 - 228
Target Start/End: Complemental strand, 9817693 - 9817563
Alignment:
| Q |
98 |
ttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgaga |
197 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||||||||||| |||||||| |||||| ||||||| ||||||||||||||||| ||||||| |
|
|
| T |
9817693 |
ttttttctgatcgatgtcgatctcagcaatgttggtaggagagaggttgtcaacggcggatgagggggaaaattgtgtttagggtttcaagataatgaga |
9817594 |
T |
|
| Q |
198 |
aatgaggatgggaggattattttgtttgatt |
228 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |
|
|
| T |
9817593 |
aatgaggatgggaggattcttttgtttgatt |
9817563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 95 - 227
Target Start/End: Complemental strand, 9817577 - 9817445
Alignment:
| Q |
95 |
ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg |
194 |
Q |
| |
|
||||||| | |||| ||||||||||||| |||||| ||||||||||||||||| | ||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9817577 |
ttcttttgtttgattgatgtcgatctcacctatggtggtaggagagaggttggcagcagcggctgagggagaaaactttgtttagggtttcaaaagaatg |
9817478 |
T |
|
| Q |
195 |
agaaatgaggatgggaggattattttgtttgat |
227 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||||| |
|
|
| T |
9817477 |
agaaatgaggattggaggattcttttgattgat |
9817445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 105 - 213
Target Start/End: Complemental strand, 9817448 - 9817341
Alignment:
| Q |
105 |
tgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgagaaatgagg |
204 |
Q |
| |
|
||||||||||||||| ||| ||||||| || |||||||||||||| ||||| |||||||||||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
9817448 |
tgatcgatgtcgatc-cagcgatggtggtatgagagaggttggcagcggcggctgagggagaaaactgtgtttagggtttctagagaatgagaaatgagg |
9817350 |
T |
|
| Q |
205 |
atgggagga |
213 |
Q |
| |
|
||||||||| |
|
|
| T |
9817349 |
atgggagga |
9817341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 9817813 - 9817777
Alignment:
| Q |
1 |
tgaagtttcatgaaaactccatcaaaagagataacca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9817813 |
tgaagtttcatgaaaattccatcaaaagagataacca |
9817777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 91 - 227
Target Start/End: Complemental strand, 11708 - 11572
Alignment:
| Q |
91 |
atggttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagag |
190 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| ||||||| || |||||||||||| | ||| ||||| || |||| ||||||| | | |||||||| |
|
|
| T |
11708 |
atggttcttttttccaatcgatgttgatctcagcgatggtggtatgagagaggttggtagcgggagttgagagataaaactttgttttgagattcaagag |
11609 |
T |
|
| Q |
191 |
aatgagaaatgaggatgggaggattattttgtttgat |
227 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||||||| |
|
|
| T |
11608 |
aatgggaagtgaggatgggaggattcttttgtttgat |
11572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 95 - 213
Target Start/End: Complemental strand, 11585 - 11467
Alignment:
| Q |
95 |
ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg |
194 |
Q |
| |
|
||||||| | ||||| ||||||||||||| | | ||| ||| ||||||||||||| || || ||||||||||| | ||| | || ||||| |||||| |
|
|
| T |
11585 |
ttcttttgtttgatcaatgtcgatctcagcggtagtggtagaagagaggttggcagcgacggccgagggagaaaactgtgtgtgggatttcatgagaata |
11486 |
T |
|
| Q |
195 |
agaaatgaggatgggagga |
213 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11485 |
agaaatgaggatgggagga |
11467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 11821 - 11788
Alignment:
| Q |
1 |
tgaagtttcatgaaaactccatcaaaagagataa |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11821 |
tgaagtttcatgaaaactccatcaaaagagataa |
11788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University