View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_425 (Length: 228)
Name: NF6867A_low_425
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_425 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 16023583 - 16023362
Alignment:
| Q |
7 |
gtttattaccttcttcggaagtcgatgattttgttgatagcttcatcaacatggatcaatatgcagatcatgagtctcaagagaagaatcatcaaagtca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16023583 |
gtttattaccttcttcggaagtcgatgactttgttgatagcttcatcaacatggatcaatattcagatcatgagtctcaagagaagaatcatcaaagtca |
16023484 |
T |
|
| Q |
107 |
aagttttgatcatcactttttggtgaatgaagatgtcattgaatatgatccaaccacattggaggatgaagaattagagatctgcaaaaatacaacgatc |
206 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||| ||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16023483 |
aagttttgatcataactttttggtgaatgatgatgtttttggatatgatccaaccacaatggaggatgaagaattagagatctgcgaaaatacaacgatc |
16023384 |
T |
|
| Q |
207 |
acaatggaagacgaagaagttg |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
16023383 |
acaatggaagacgaagaagttg |
16023362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University