View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_426 (Length: 228)
Name: NF6867A_low_426
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_426 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 31133890 - 31134027
Alignment:
| Q |
1 |
aaaacaaaacttggcttattccacaccactgtgagtttagaaaacaaaaacattgcccgaatgcctcccccctcagttccatcccccaccaaatccctaa |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||||||||| || ||||||||||||| |||||||| |||||| |
|
|
| T |
31133890 |
aaaacaaaagttggcttattccacaccactgtgagtttagaaaacaaaaacatttgctgaatgcctctcctctcagttccatccaccaccaaaaccctaa |
31133989 |
T |
|
| Q |
101 |
attctccatcccctttctatcaccaccatgccactttc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31133990 |
attctccatcccctttctatcaccaccatgccactttc |
31134027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University