View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_432 (Length: 227)
Name: NF6867A_low_432
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_432 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 13293098 - 13292871
Alignment:
| Q |
7 |
aaagggtttggccttgcgaccactcaggttagaggttatttccaggttaaggcatatcaaacaatttcgatgtttatgttaaagaagacaattttagtac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13293098 |
aaagggtttggccttgcgaccactcaggttagaggttatttccaggttaaggcatatcaaacaatttcgatgtttatgttaaagaagacaattttagtac |
13292999 |
T |
 |
| Q |
107 |
tgaaaatatatacaagtaaccagtgattcatattttca------annnnnnnaacaagactaggctcttaattggaatcatatgaagttgttaaa-aact |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | | || |||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
13292998 |
tgaaaatatatacaagtaaccagtgattcatattattattatttttttttttaataagactaggctcttaattggaatcatatgaagttcttaaacaact |
13292899 |
T |
 |
| Q |
200 |
ttagaatataggaattctactcgtatat |
227 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
13292898 |
ttagaatataggaattctactagtatat |
13292871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University