View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_440 (Length: 226)
Name: NF6867A_low_440
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_440 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 44422682 - 44422881
Alignment:
| Q |
17 |
ggctggtgttgaatccattcaggcttccgctagaaggagaggtggataggtacatccttctgccatctgataaaacagcaacaagatgtagcgatttcga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44422682 |
ggctggtgttgaatccattcaggcttccgctagaaggagaggtggataggtacatccttctaccatctgataaaacagcaacaagatgtagcgatttcga |
44422781 |
T |
|
| Q |
117 |
ttcaagggtagataagggtgagatgcaaacaatagatggctttggtgatcgacttgatactcttgatccacttgattgtctacctccatgatgtccatct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44422782 |
ttcaagggtagataagggtgagatgcaaacaatagatggctttggtgatcgacttgatactcttgatccacttgattgtctacctccatgatgtgcatct |
44422881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University