View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_442 (Length: 225)
Name: NF6867A_low_442
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_442 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 8 - 192
Target Start/End: Complemental strand, 32892062 - 32891878
Alignment:
| Q |
8 |
acatcaaagaacttggaatacaattaagaacatcaaattgctgatgtttagattactactcggagtcaaaccatgaacaatatggaagatggggagacaa |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32892062 |
acatcaaagaacttggaatacaatgaagaacatcaaattgttgatgttgagattactactcggagtcaaaccatgaacaatatggaagatggggagacaa |
32891963 |
T |
 |
| Q |
108 |
gttttctggtcatgttagaaaattcttgcggaccatagcgttccaagagaaacgcactctttggaacttttcgacgtctattgtt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32891962 |
gttttctggtcatgttagaaaattcttgcggaccatagcgttccaagagaaacgcactctttggaacttttcgacgtctattgtt |
32891878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University