View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_452 (Length: 223)
Name: NF6867A_low_452
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_452 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 4584918 - 4585099
Alignment:
| Q |
18 |
gtttgccgtaatataaaggttggcaatgtaaccgcgtcagtaaattaaaagcatgataccactaaaaatggaactaaaatgaaaatctgaaagcttgat- |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4584918 |
gtttgccgtaatataaaggttggcaatgtaaccgcgtcagtaaattaaaagcatgataccagtaaaaatggaactaaaatgaaaatctgaaagcttgata |
4585017 |
T |
|
| Q |
117 |
atccctaatactgaaaatagtat-aaatacaatgaaaagattgcataact-aaacaactctatgaaaatctatgccaaatct |
196 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
4585018 |
atccctaatactgaaaacggtataaaatacaatgaaaagattgcataactaaaacaactctatgaaaatttatgccaaatct |
4585099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University