View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_464 (Length: 221)
Name: NF6867A_low_464
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_464 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 37492329 - 37492128
Alignment:
| Q |
1 |
ggattggatcagaatggatcggattggacggaacacagcttctgtaatctgaactgctttgctccttatcctttgccatttcaagtaaaacaaccaaaga |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492329 |
ggattggatcggaatggatcggattggacggaacacagcttctgtaatctgaactgctttgctccttatcctttgccatttcaagtaaaacaaccaaaga |
37492230 |
T |
 |
| Q |
101 |
aatcaaagcatcattacaaaaataagagtagcatcattctaatttgaaattaaatgtaaacagaatgatcttaaccactatgcagtatgcacatacacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37492229 |
aatcaaagcatcattacaaaaataagagtagcatcattctgatttgaaattaaatgtaaacagaatgattttaaccactatgcagtatgcacatacacca |
37492130 |
T |
 |
| Q |
201 |
tg |
202 |
Q |
| |
|
|| |
|
|
| T |
37492129 |
tg |
37492128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University