View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_467 (Length: 220)
Name: NF6867A_low_467
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_467 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 50 - 220
Target Start/End: Original strand, 43703392 - 43703561
Alignment:
| Q |
50 |
caattttataaacttatgttcatctaaaaccacctttatcgaacacttgcccaaatgcacactctttttcgtattgataatgaattacttttgttggttc |
149 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43703392 |
caattttataaacttatgtttatctaaaaccacctttatcgaacacttgcccaaatgcacactttttttcgtattgataatgaattacttttgtt-gttc |
43703490 |
T |
|
| Q |
150 |
aaccacctacattgaggaatcaaaatactagttgagtttgtcttgtgagattcttatcttgtgattggtcc |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703491 |
aaccatctacattgaggaatcaaaatactagttgagtttgtcttgtgagattcttatcttgtgattggtcc |
43703561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University