View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_473 (Length: 219)
Name: NF6867A_low_473
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_473 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 21378359 - 21378540
Alignment:
| Q |
20 |
actatattcactccaagctatcttcagttaaccaacctgctatttatggtaaccttattggaacagggaactattttgttgttgtagggcttggtactcc |
119 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21378359 |
actatattcactccaagctatcttcagataacctacctgctatttatggtaaccttattggaacagggaactattttgttgttgtagggcttggtactcc |
21378458 |
T |
|
| Q |
120 |
taaaaggaacttgtctcttgtttttgatactggtagtgatctcacttggactcagtgtcaaccttgtgatcgtctttgttac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
21378459 |
taaaaggaacttgtctcttgtttttgatactggtagtgatctcacttggactcagtgtcaaccttgtgctcgtccttgttac |
21378540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 66 - 187
Target Start/End: Original strand, 21404874 - 21404995
Alignment:
| Q |
66 |
tggtaaccttattggaacagggaactattttgttgttgtagggcttggtactcctaaaaggaacttgtctcttgtttttgatactggtagtgatctcact |
165 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||||||| |||||||||| |||||||||| | | ||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
21404874 |
tggtagccttattggatcagggaattattttgttgttttagggcttggaactcctaaaaaggatttgtcacttatttttgacactggtagtgatctcact |
21404973 |
T |
|
| Q |
166 |
tggactcagtgtcaaccttgtg |
187 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
21404974 |
tggactcaatgtcaaccttgtg |
21404995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University