View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_483 (Length: 216)
Name: NF6867A_low_483
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_483 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 10 - 216
Target Start/End: Original strand, 38298355 - 38298567
Alignment:
| Q |
10 |
ctggtaggtcgtctcagacgagatttaatgtagaggtcaatttatggggatccaacattaatata------ttccaaatgtggatgttgaagatttgttg |
103 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
38298355 |
ctggtaggtcgtctcagacgatatttaatgtagaggtcaatttatggggatccaacattaatataggagtattccaaatgtggatgttgaagatttggtg |
38298454 |
T |
|
| Q |
104 |
aaccaatcatatgacattagcgattttattccaatagacattttatccgacaaaaaataaacgatattcatttatttatttgatagagcataaaaggtta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38298455 |
aaccaatcatatgacattagcgattttatttcaatagatattttatccgacaaaaaataaacgatattcatttatttatttgatagagcataaaaggtta |
38298554 |
T |
|
| Q |
204 |
agacggagattga |
216 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
38298555 |
agacagagattga |
38298567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University