View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_485 (Length: 215)
Name: NF6867A_low_485
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_485 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 138
Target Start/End: Original strand, 46684716 - 46684749
Alignment:
| Q |
105 |
tttttgtttcatttcatcatcatcattgtcaatt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46684716 |
tttttgtttcatttcatcatcatcattgtcaatt |
46684749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University