View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_490 (Length: 213)
Name: NF6867A_low_490
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_490 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 33104705 - 33104508
Alignment:
| Q |
16 |
tggacatcaaggttaattatatacctgaacaatagctacacgtaaaaggttaccacgcagtccaacagcaatggaagctgcagccatgactgcaggacct |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33104705 |
tggaaatcaaggttaattatatacctgaacaatagctacacgtaaaaggttaccacgcagtccaacagcaatggaagctgcagccatgactgcaggacct |
33104606 |
T |
 |
| Q |
116 |
gtaagaaatcgaacagccattgcaaatgaagcaactgagtttccacatgcaatcatcttgggttgtagagccataaacaaacctgtgcatatgcaaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33104605 |
gtaagaaatcgaacagccattgcaaatgaagcaactgagtttccacatgcaatcatcttgggttgtagagccataaacaaacctgtgcatatgcaaac |
33104508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 38 - 199
Target Start/End: Original strand, 10835806 - 10835967
Alignment:
| Q |
38 |
acctgaacaatagctacacgtaaaaggttaccacgcagtccaacagcaatggaagctgcagccatgactgcaggacctgtaagaaatcgaacagccattg |
137 |
Q |
| |
|
|||||||||||||||||| ||| ||| | ||||| || ||||| || || |||||||| ||||| ||||| ||||| ||||| |||| | |||||| | |
|
|
| T |
10835806 |
acctgaacaatagctacatgtaggagggtcccacggaggccaacggcgatagaagctgctgccataactgctggaccagtaaggaatcttatagccatgg |
10835905 |
T |
 |
| Q |
138 |
caaatgaagcaactgagtttccacatgcaatcatcttgggttgtagagccataaacaaacct |
199 |
Q |
| |
|
||||||||||||| || || ||||||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
10835906 |
caaatgaagcaacagaattcccacatgcaatgatcttgggttgaagagccataaacagacct |
10835967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University