View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_494 (Length: 211)
Name: NF6867A_low_494
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_494 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 24301084 - 24301264
Alignment:
| Q |
19 |
acctagtaaaatatctttaactttatgctcattcttgtaccaattttcatttgggcttcgaagcccgcagtgtgggttcggatgagcatctgtttagagc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |||| ||| |||||| |||| |
|
|
| T |
24301084 |
acctagtaaaatatctttaactttatgctcattcttgtaccaattttcacttgggctttgaagcccgcagtgtgggttatgatgcgcacctgtttggagc |
24301183 |
T |
|
| Q |
119 |
tattgatgagcttttttcaactcaacgaggaaacttttcttcaacattgatcagagtccactccaacacttccaaaatatt |
199 |
Q |
| |
|
||| ||||||||| | || |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24301184 |
catttatgagctttcatacgcttaacggagaaacttttcttcaacattgatcagagtccactccaacacttccaacatatt |
24301264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University