View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_495 (Length: 211)
Name: NF6867A_low_495
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_495 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 36 - 192
Target Start/End: Complemental strand, 26793648 - 26793490
Alignment:
| Q |
36 |
ataggtttttgaaaggctaggcctagtggaacttagttttagcttttgttaattaaa--gtagtcgagaaatcaagtgcgcttaaacnnnnnnnattgaa |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
26793648 |
ataggtttttgaaaggctaggcctagtggaacttagttttagcttttgttaattaaagtgtagtcgagaaatcaagtgcgcttaaactttttttattgaa |
26793549 |
T |
 |
| Q |
134 |
aagaaaagaagcattagtaaacgaatacttcacggtacacattaatctgaggaatatat |
192 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26793548 |
aagaaaagaagcattagaaaacgaatacttcaaggtacacattaatctgaggaatatat |
26793490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University