View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_498 (Length: 210)
Name: NF6867A_low_498
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_498 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 27 - 155
Target Start/End: Complemental strand, 30922826 - 30922699
Alignment:
| Q |
27 |
cgaagaatatcactcaacgacttcagtgggattttccaccaattctctgaagaactccactgaaaattatctcagcccttagaaaagaaaatatatgcat |
126 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||| |||| |||||||| |
|
|
| T |
30922826 |
cgaagaaaatcactcaacgacttcagtgggattttccaccaattttctgaagaactccactgaaaattatctcagcacgtagaaaa-aaaaaatatgcat |
30922728 |
T |
|
| Q |
127 |
tattctcgtaacccctcactcaattcaat |
155 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30922727 |
tattctcgtaacccctcactcaattcaat |
30922699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 194
Target Start/End: Complemental strand, 30922667 - 30922629
Alignment:
| Q |
156 |
atgcataatcttcattaactttttcgctctgcttgatgt |
194 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
30922667 |
atgcataatcttaattaactttttccctctgcttgatgt |
30922629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University