View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_504 (Length: 209)
Name: NF6867A_low_504
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_504 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 194
Target Start/End: Original strand, 37085 - 37259
Alignment:
| Q |
20 |
aagatttctttgcaagatgttgaatttggtgaagatcaagaattaagccatgatgataaaatttgatgaaatgagtgcatatagttatgacacacattgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37085 |
aagatttctttgcaagatgttgaatttggtgaagatcaagaattaagccatgatgataaaatttgatgaaatgagtgcatatagttatgacacacatttc |
37184 |
T |
|
| Q |
120 |
tttatctgcatcttttgtctagttaaaatggtagtaaaagttggtatgcatctgcttgcacttgcacatattcat |
194 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37185 |
tttatttgcatcttttgtctagttaaaatggtagtaaaacttggtatgcatctgcttgcacttgcacatattcat |
37259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University