View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_510 (Length: 206)
Name: NF6867A_low_510
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_510 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 333690 - 333516
Alignment:
| Q |
15 |
aacctgtgcaaggattcgaatttttgcaagtttttcaacaaagtcgatgccaacttccctttgtaaaacatctttgagaagatttccaagcagcttacag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
333690 |
aacctgtgcaaggattcgaatttttgcaagtttttcaacaaagtcgatgccaacttccctttgtaaaacatctttgagaagatttccaagcaacttacag |
333591 |
T |
 |
| Q |
115 |
tcatcgtcgaagccttggaaggacatttcctcggcaatgtcatcagtagtgtccgtcatgtttactcgaacacag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
333590 |
tcatcgtcgaagccttggaaggacatttcctcggcaatgtcatcagtagtgtccgtcatgtttactcgaacacag |
333516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University