View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6867A_low_513 (Length: 205)

Name: NF6867A_low_513
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6867A_low_513
NF6867A_low_513
[»] chr3 (1 HSPs)
chr3 (92-182)||(46687400-46687490)


Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 92 - 182
Target Start/End: Original strand, 46687400 - 46687490
Alignment:
92 ggtttctgggatgattgtgatgtctttggagataacgtttgtatgaggatcgatgccgggaggaacgacggcaatgccggcgtatctttcg 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
46687400 ggtttctgggatgattgtgatgtctttggagataacgtttgtatgaggatcgatgccgggaggaacgacggcaatgccggcatatctttcg 46687490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University