View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6867A_low_518 (Length: 202)

Name: NF6867A_low_518
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6867A_low_518
NF6867A_low_518
[»] chr2 (3 HSPs)
chr2 (58-159)||(2490138-2490239)
chr2 (20-55)||(2490261-2490296)
chr2 (55-99)||(2496658-2496702)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 58 - 159
Target Start/End: Complemental strand, 2490239 - 2490138
Alignment:
58 taaactcaacattaaacaaaatgttaaataggcttagaagtttaatctcaccttttaaagttaactcaaaggatgaggatgtccattttacaagcgcgcg 157  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
2490239 taaactcaacattaaacaaaatgttaaataggcttagaagtttaatctcaccttttaaagttaactctaaggatgaggatgtccattttacaagcgcgcg 2490140  T
158 cg 159  Q
    ||    
2490139 cg 2490138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 55
Target Start/End: Complemental strand, 2490296 - 2490261
Alignment:
20 atatgagccttccctaagtttagttatacttaataa 55  Q
    ||||||||||||||||||||||||||||||||||||    
2490296 atatgagccttccctaagtttagttatacttaataa 2490261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 99
Target Start/End: Complemental strand, 2496702 - 2496658
Alignment:
55 agataaactcaacattaaacaaaatgttaaataggcttagaagtt 99  Q
    ||||||| ||||||||||||||| |||||||| | ||||||||||    
2496702 agataaattcaacattaaacaaagtgttaaatggacttagaagtt 2496658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University