View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_524 (Length: 201)
Name: NF6867A_low_524
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_524 |
 | |
|
| [»] scaffold0175 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 24 - 181
Target Start/End: Complemental strand, 31502812 - 31502655
Alignment:
| Q |
24 |
tctccaagaatatatcaatataagatgggacatgtctataccgcataaagtcttgtgtgatgatccatatatatttcaagctctttcctttggaattgca |
123 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31502812 |
tctccaataatatatcaatataggatgggacatgtctacaccgtataaagtcttgtgtgatgatccatatatatttcaagctctttcctttggaattgca |
31502713 |
T |
|
| Q |
124 |
cttataaaatgtggaagtacacactaccttttatgtgcattttactcttctttttact |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31502712 |
cttataaaatgtggaagtacacactaccttttatgtgcattttactcttctttttact |
31502655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 24 - 181
Target Start/End: Original strand, 29276166 - 29276331
Alignment:
| Q |
24 |
tctccaagaatatatcaatataagatgggacatgtctataccgcataaagtcttgtgtgatgatccatatatatttcaagctctttcctttgga------ |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
29276166 |
tctccaataatatatcaatataagatgggacatgtctataccgtataaagtct--tgtgatgatccatatatatttcaagctcttcccttaggaatatga |
29276263 |
T |
|
| Q |
118 |
----attgcacttataaaatgtggaagtacacactaccttttatgtgcattttactcttctttttact |
181 |
Q |
| |
|
||||||||||| |||||| || ||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
29276264 |
tactattgcacttattaaatgtacaaatacacactaccctttgtgtgcattttactcttctttttact |
29276331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 32 - 175
Target Start/End: Complemental strand, 55858418 - 55858267
Alignment:
| Q |
32 |
aatatatcaatataagatgggacatgtctataccgcataaagtcttgtgtgatgatccatatatatttcaagctctttcctttgga----------attg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||| ||| |||| |
|
|
| T |
55858418 |
aatatatcaatataagatgggacatgtctataccgtataaagtct--tgtgatgatccatatatatttcaagctcttaccttaggaatatgatactattg |
55858321 |
T |
|
| Q |
122 |
cacttataaaatgtggaagtacacactaccttttatgtgcattttactcttctt |
175 |
Q |
| |
|
||||||| |||||| || ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
55858320 |
cacttattaaatgtacaaatacacactaccctttgtgtgcattttactcttctt |
55858267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0175 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0175
Description:
Target: scaffold0175; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 141 - 181
Target Start/End: Complemental strand, 27959 - 27919
Alignment:
| Q |
141 |
tacacactaccttttatgtgcattttactcttctttttact |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27959 |
tacacactaccttttatgtgcattttactcttctttttact |
27919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University