View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_527 (Length: 201)
Name: NF6867A_low_527
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_527 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 43410766 - 43410966
Alignment:
| Q |
1 |
gaacaacttggttctaaaatatttggatgatgaaggagaatgggttgtgttatcatgtgatgctgatcttgaagaatgtaaagacttgcacacatcatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410766 |
gaacaacttggttctaaaatatttggatgatgaaggagaatgggttgtgttatcatgtgatgctgatcttgaagaatgtaaagacttgcacacatcatct |
43410865 |
T |
|
| Q |
101 |
cacacacgtaccattagactctctctttttcaagcttcccctctcaatcttccaaacactttccgcaacagcagcagcagcagtccatcctcctagctag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410866 |
cacacacgtaccattagactctctctttttcaagcttcccctctcaatcttccaaacactttccgcaacagcagcagcagcagtccatcctcctagctag |
43410965 |
T |
|
| Q |
201 |
c |
201 |
Q |
| |
|
| |
|
|
| T |
43410966 |
c |
43410966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University