View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_528 (Length: 201)
Name: NF6867A_low_528
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_528 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 8519873 - 8519699
Alignment:
| Q |
15 |
acatcagcataaacaatagaaaactctataaaatggacttcgatgtttcactctctttaaaaccttcagtaagcagtcagtctcatgagcaacttggcaa |
114 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
8519873 |
acatcagcataaacaatagaagactctataaaatggacttcgatgtttcactctctttaaaaccttcaataagcagtcagtctcatgagcaacttgtcaa |
8519774 |
T |
|
| Q |
115 |
tttcatgagaataaagttaacgcagcaaacgagtatggcagagacaaggttaaaccaacccaacgaacaccaaac |
189 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8519773 |
tttcgtgagaatgaagttaacgcagcaaacgagtatggcagagacaaggttaaaccaacccaacgaacaccaaac |
8519699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University