View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_53 (Length: 393)
Name: NF6867A_low_53
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 5e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 30797281 - 30797130
Alignment:
| Q |
18 |
ttttctctctaacaaaagatatggtttgtcttatgcttgtaatgaccctagtttagataacagtaagattttcattcaacccaacatattttaaggccta |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30797281 |
ttttctgtctaacaaaagatatggtttgtcttatgcttgtaatgaccctagtttagataacagtaagattttcattcaacccaaaatattttaaggccta |
30797182 |
T |
|
| Q |
118 |
aaaggaattatgttgtgaagtttttatataagatttcaaacgtgtcaaatgg |
169 |
Q |
| |
|
||| |||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30797181 |
aaacgaattatgatgtgaagtttttatataagatttcaaatatgtcaaatgg |
30797130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University