View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_86 (Length: 358)
Name: NF6867A_low_86
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_86 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 9e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 38 - 258
Target Start/End: Original strand, 24883417 - 24883631
Alignment:
| Q |
38 |
tcccaaaattgtccatgtctctacaagaattagataagcaacaaatatgtgccaaatattttcaccatattccccccacctaaagcagttgcgagggcaa |
137 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24883417 |
tcccaaaattttccatgtctctacaagaattagataagcaacaaatatgtgccaaatattttcaccatattccccccacctaaagc------gagggcaa |
24883510 |
T |
|
| Q |
138 |
attatannnnnnnngttatcgatttgttcaagttggtaaacaatctcacatcatacgccatataaaattctttacaacatgaggagcttccaaactccat |
237 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24883511 |
attatattttttttgttatcgatttgttcaagttggtaaataatctcacatcatacgccatataaaattctttacaacatgaggagcttccaaactccat |
24883610 |
T |
|
| Q |
238 |
actaaagaccgatcatcattc |
258 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24883611 |
actaaagaccgatcatcattc |
24883631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 296 - 336
Target Start/End: Original strand, 24883650 - 24883690
Alignment:
| Q |
296 |
gagtttgtttgacctgatttttcgaattgactcaactcatg |
336 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
24883650 |
gagtttgtttgagttggtttttcgaattgactcaactcatg |
24883690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University