View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6867A_low_98 (Length: 351)
Name: NF6867A_low_98
Description: NF6867A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6867A_low_98 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 7 - 342
Target Start/End: Complemental strand, 38244002 - 38243666
Alignment:
| Q |
7 |
aaaccattactacgccaccgccgcagataccgcctttcgatcaccaacctcatcagtattatggaccatccgccgatgaagttttcgccaagcgtaaaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38244002 |
aaaccattactacgccaccgccgcagataccgccgttcgatcaccaacctcatccgtattatggaccatccgccgatgaagttttctccaagcgtaaaca |
38243903 |
T |
 |
| Q |
107 |
gttccttggtccttccttgttccatttctatcaaaaacccgtcagttcctatcatcaaactcatttctcttctttaatttcatttattgtttgttac-nn |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243902 |
gttccttggtccttccttgttccatttctatcaaaaacccgtcagttcctatcatcaaactcatttctcttctttaatttcatttattgtttgttacttt |
38243803 |
T |
 |
| Q |
206 |
nnnnnnatagaagaagaaattgatgatgaatgatgtttgtatagttgaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgtta |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243802 |
ttttttatagaagaagaaattgatgatgaatgatgtttttatagttgaatattgtggaggggaagatgcaatatctgtatgatgaagctggaagacgtta |
38243703 |
T |
 |
| Q |
306 |
ccttgatgcttttgctgggattgtcacaggttctgct |
342 |
Q |
| |
|
|||||||||||||||||||||||| || | ||||||| |
|
|
| T |
38243702 |
ccttgatgcttttgctgggattgttactgtttctgct |
38243666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University