View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_100 (Length: 296)
Name: NF6868A_low_100
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_100 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 19 - 275
Target Start/End: Complemental strand, 12271337 - 12271081
Alignment:
| Q |
19 |
ttcattccaatgaagccttatttgttttctcttttaaccattttaacagagagattatcagtacaaccaactctgaggtcttttgcttaagaagcgcatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12271337 |
ttcattccaatgaagccttatttgttttctcttttaaccattttaacagagagattatcagtacaaccaactctgaggtcttttgcttaagaagtgcatc |
12271238 |
T |
 |
| Q |
119 |
cttgccaagatgtcggagacaaagaatcaagctttattttagcttgtgctcagggacaacaaatgaatagattccttcatcctcaagaattgcatgatgc |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12271237 |
cttgccaggatgtcggagacaaagaatcaagctttattttagcttgtgctcagggacaacaaatgaatagattccttcatcctcaagaattgcatgatgc |
12271138 |
T |
 |
| Q |
219 |
agtacgacaaggcctgattggtttagtctaaccatactttaccgcgtattgcagttg |
275 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12271137 |
agtacgacaaggcctaattggtttagtctaaccatactttaccgcgtattgcagttg |
12271081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University