View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_104 (Length: 291)
Name: NF6868A_low_104
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_104 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 101 - 268
Target Start/End: Original strand, 7899319 - 7899486
Alignment:
| Q |
101 |
aatattctcgtcatttaacagaagcaaaattattccaaaaatctactttactgaatgcttgatttgtaagatagaagtgtcattgcactagatgtatgcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7899319 |
aatattctcgtcatttaacagaagcaaaattattccaaaaatctactttactgaatgcttgatttgtaagatagaagtgtcattgcactagatgtatgcc |
7899418 |
T |
|
| Q |
201 |
aaaaactccttgcacattaaccaactgaagccatgtgtcggatcaagtcaaccacgcgtgagctgtat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7899419 |
aaaaactccttgcacattaaccaactgaagccatgtgtcggatcaagtcaaccacgcgtgagctgtat |
7899486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 16 - 82
Target Start/End: Complemental strand, 6915721 - 6915655
Alignment:
| Q |
16 |
tagaagtcattgtgtatttattcgacccatcagaaaatgtatcgcaggatgaacaatcaacaccaaa |
82 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
6915721 |
tagaagtcattgtgtatttaaccgacccatcagtaaatgtatcgctggatgcacaatcaacaccaaa |
6915655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University