View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_133 (Length: 271)
Name: NF6868A_low_133
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_133 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 11 - 271
Target Start/End: Complemental strand, 5983720 - 5983460
Alignment:
| Q |
11 |
gtgttattcggaaactgatgaaattgtcgccttcaccgattggtattttaacatctttcgtttgattggctgatatatcatcatcaaaattctccatatc |
110 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5983720 |
gtgttattcggacaccgatgaaattgtcgccttcaccgattggtattttaaaatctttcgtttgatcggctgatatatcatcatcaaaattctccatatc |
5983621 |
T |
 |
| Q |
111 |
tataatggatacaaggtgaagacttgtccctcggctagcatgcctcttttatttctcttgaatgagtttctctttgaatgatccccgagaaaccatttcg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
5983620 |
tataatggatacaaggtgaagacttgtccctcggctagcatgcctcttttatttctcttgaatgagtttctctttgaatgatcctcgagaatccatttcg |
5983521 |
T |
 |
| Q |
211 |
ctcgaatcttggcatgcttgtccaatcaatttctcttttagttatgcatgcatataattga |
271 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5983520 |
ttcaaatcttggcatgcttgtccaatcaatttctcttttagttatggatgcatataattga |
5983460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University