View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_154 (Length: 258)
Name: NF6868A_low_154
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_154 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 93 - 253
Target Start/End: Original strand, 40758314 - 40758474
Alignment:
| Q |
93 |
taagcattgtgatattattgatgttgaaagaactgttatgctgatgttatttataccgaaagaataatgtatacacaaggaatctattttcaatagattt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758314 |
taagcattgtgatattattgatgttgaaagaattgttatgctgatgttatttatactgaaagaataatgtatacacaaggaatctattttcaatagattt |
40758413 |
T |
|
| Q |
193 |
aacattaaaatattacaatggaaaatccagtcaaattttgtgcaagaccgcagtagtaact |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758414 |
aacattaaaatattacaatggaaaatccagtcaaattttgtgcaagaccgcagtagtaact |
40758474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University