View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_156 (Length: 258)
Name: NF6868A_low_156
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_156 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 258
Target Start/End: Original strand, 38814608 - 38814847
Alignment:
| Q |
19 |
acatcaatcaactgtgcctcctccaagaaattgggatctcgaaatttcacatgcagctcatcaggttgaatgtctagaagtactggttcttccctgacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38814608 |
acatcaatcaactgtgcctcctccaagaaattgggatcttgaaatttcacatgcagctcatcaggttgaatgtctagaagtactggttcttccctgacaa |
38814707 |
T |
|
| Q |
119 |
ttaatggagtaaatttacaaggcatgagaaactcattaaaacaaacaactactatcatcccataaggtgatgttggctaattggatcgaacaatcaatta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38814708 |
ttaatggagtaaatttacaaggcatgagaaactcattaaaacaaacaactactatcatcccataaggtgatgttggctaattggatcaaacaatcaatta |
38814807 |
T |
|
| Q |
219 |
gggttaataaatagccaaatattcaatgaatttcacattg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38814808 |
gggttaataaatagccaaatattcaatgaatttcacattg |
38814847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 38821066 - 38821160
Alignment:
| Q |
19 |
acatcaatcaactgtgcctcctccaagaaattgggatctcgaaatttcacatgcagctcatcaggttgaatgtctagaagtactggttcttccct |
113 |
Q |
| |
|
|||||||| ||||||||||||| | |||| ||||||||| ||| ||||||||||||||||||||||||||||||| ||| ||| | ||||||||| |
|
|
| T |
38821066 |
acatcaattaactgtgcctccttcgagaagttgggatcttgaagtttcacatgcagctcatcaggttgaatgtcttgaaatacagattcttccct |
38821160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University