View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_157 (Length: 258)
Name: NF6868A_low_157
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_157 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 248
Target Start/End: Complemental strand, 41410578 - 41410340
Alignment:
| Q |
11 |
cttctgctcacactagcaggttcctttccttcttgccaaaaccgtgccatctgaatatgtaatcccttccttctcctggtcctgaatatgtaatcctttt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41410578 |
cttctgctcacactagcaggttcctttccttcttgccaaaaccttgccatctgaatatgtaatcccttccttctcctggtcctgaatatgtaatcccttt |
41410479 |
T |
|
| Q |
111 |
catctcttggtccttggtgcatggaccagtttccaagctaaaagctttcagctgtaaattattgcaagatacataaattag-caaactgaatgggtttca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
41410478 |
catctcttggtccttggtgcatggaccaggttccaagctaaaagctttcagctgtaaattattgcaagatacataaattagccaaactgaatggttttca |
41410379 |
T |
|
| Q |
210 |
atttcgcacaaaatgatatgcttgggttcttattaacac |
248 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41410378 |
atttcacacaaaatgatatgcttgggttcttattaacac |
41410340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 113 - 197
Target Start/End: Complemental strand, 2978956 - 2978872
Alignment:
| Q |
113 |
tctcttggtccttggtgcatggaccagtttccaagctaaaagctttcagctgtaaattattgcaagatacataaattagcaaact |
197 |
Q |
| |
|
||||| |||||||||||| || ||||| ||||||||| |||||||||| || | | ||||||||||||||||||||||| ||||| |
|
|
| T |
2978956 |
tctctaggtccttggtgcgtgtaccaggttccaagctgaaagctttcacctttgatttattgcaagatacataaattagaaaact |
2978872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 85
Target Start/End: Complemental strand, 2979027 - 2978953
Alignment:
| Q |
11 |
cttctgctcacactagcaggttcctttccttcttgccaaaaccgtgccatctgaatatgtaatcccttccttctc |
85 |
Q |
| |
|
|||||||||||||| | |||| ||| ||| ||||||||||||| |||||||||| | | |||||||||||||| |
|
|
| T |
2979027 |
cttctgctcacacttgtaggtccctctccctcttgccaaaacctcaccatctgaatctatgatcccttccttctc |
2978953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 37519439 - 37519393
Alignment:
| Q |
151 |
aaagctttcagctgtaaattattgcaagatacataaattagcaaact |
197 |
Q |
| |
|
||||| |||| |||||| |||||||||||||||||||||||| |||| |
|
|
| T |
37519439 |
aaagcattcatctgtaatttattgcaagatacataaattagccaact |
37519393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University