View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_170 (Length: 251)
Name: NF6868A_low_170
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_170 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 11 - 239
Target Start/End: Complemental strand, 6454888 - 6454660
Alignment:
| Q |
11 |
acggaatcctacacgattcccaaaggtgcaatagtttttccgtcagcattcgagtcatcttttcagggttttactgaaccggaccggttcgacccagacc |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454888 |
acggaatcttacacgattcccaaaggtgcaatagtttttccgtcagcattcgagtcatcttttcagggttttactgaaccggaccggttcgacccagacc |
6454789 |
T |
 |
| Q |
111 |
ggttttcagaagaaagacaagaggatcaaatatttaaaagaaactttctagcatttggagctgggccccaccaatgtgtgggccagaggtacgctttgaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454788 |
ggttttcagaagaaagacaagaggatcaaatatttaaaagaaactttctagcatttggagctgggccccaccaatgtgtgggccagaggtacgctttgaa |
6454689 |
T |
 |
| Q |
211 |
tcatcttgtgcttttcattgctatgttca |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6454688 |
tcatcttgtgcttttcattgctatgttca |
6454660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University