View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_178 (Length: 250)
Name: NF6868A_low_178
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_178 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 39480137 - 39480376
Alignment:
| Q |
11 |
gagatggacatcaaccgaatcttcttccaagtttagctctgtgtttgccaagatcatagcagcaccgcctgcttccttcacagcttgacccttttctgat |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39480137 |
gagatgaacatcaaccgaatcttcttccaagtttagctctgtgtttgccaagatcatagcagcaccacctgcttccttcacagcttgacccttttctgat |
39480236 |
T |
|
| Q |
111 |
cttccgttgacacctcgatcacataccaccatttttccttgaactttgtcctttggaagagaccctttgaggcgaaattgactctcactatccccaccag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39480237 |
cttccgttgacacctcgatcacataccaccatttttccttgaactttgtcctttggaagagaccctttgaggcaaaattgactctcactatccccaccag |
39480336 |
T |
|
| Q |
211 |
agaggtaaaccagctcaagttctttgctattgcttgctat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480337 |
agaggtaaaccagctcaagttctttgctattgcttgctat |
39480376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 39127281 - 39127051
Alignment:
| Q |
18 |
acatcaaccgaatcttcttccaagtttagctctgtgtttgccaagatcatagcagcaccgcctgcttccttcacagcttgacccttttctgatcttccgt |
117 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||| || | |||||| |||||| |||||||||||||||||||||| | |
|
|
| T |
39127281 |
acatcaattgaatcttcttccaagttaagctctgtgtttgccaagatcatagcagtactacttgcttcattcacaacttgacccttttctgatcttccat |
39127182 |
T |
|
| Q |
118 |
tgacacctcgatcacataccaccatttttccttgaactttgtcctttggaagagaccctttgaggcgaaattgactctcactatccccaccagagaggta |
217 |
Q |
| |
|
||||||||| ||| |||| ||| |||| ||||||| |||| ||||||||||||| ||||||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
39127181 |
tgacacctcaatcgcatatgaccgttttgccttgaaatttgacctttggaagaga-gtattgaggc-aaattgactctcactatctccaccacttaggta |
39127084 |
T |
|
| Q |
218 |
aaccagctcaagttctttgctattgcttgctat |
250 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| |
|
|
| T |
39127083 |
aaccggctcaagttctttgccattgcttgctat |
39127051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University