View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_181 (Length: 250)
Name: NF6868A_low_181
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_181 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 5 - 230
Target Start/End: Complemental strand, 3508699 - 3508474
Alignment:
| Q |
5 |
gagctatactcgtgttggtcctgaccatataaatgatcgttatgcctatcaatatggtgcttcatctagggatgcatacttggctcctttaaggagagat |
104 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3508699 |
gagctatactcgtgttgttcctgaccatataaatgatcgttatgcctatcaatatggtgcttcatctagggatgaatacttggctcctttaaggagagag |
3508600 |
T |
 |
| Q |
105 |
gccatcgctcccagctcgtatttggttgggggaagaccttttgccaagactgataacttgcgaaggagagagatcgttgaagataggcattactcaatat |
204 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3508599 |
gccgtcgctcccagctcgtatttggttgggggaagaccttttgccgagactgataacttgcgaaggagagagatcgttgaagataggcattactcaatat |
3508500 |
T |
 |
| Q |
205 |
attctgctgctgatgctttacctgat |
230 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3508499 |
attctgctgctgatgctttacctgat |
3508474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University