View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_195 (Length: 248)
Name: NF6868A_low_195
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_195 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 5 - 242
Target Start/End: Original strand, 43825413 - 43825650
Alignment:
| Q |
5 |
atactttttaaatcggttaaactgatttcaaaattggtggaaccgatcttaaaaatgctgaacgccattaactgaagagccgaacaataatttaagtgtc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43825413 |
atactttttaaatcggttaaactgatttcaaaattggtggaaccgatcttaaaaatgctgaacgccattaactgaagagccgaacaataatttaagtgtc |
43825512 |
T |
|
| Q |
105 |
actcgaccaacatcagttcnnnnnnngaaaatttaagaagtgagaagagtaacttttaaatatggattcatttttaaatctatttttcttttggttgtaa |
204 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43825513 |
actcgaccgacatcagttcaaaaaaagaaaatttaagaagtgagaagagtaacttttaaatatggattcatttttaaatctatttttcttttggttgtaa |
43825612 |
T |
|
| Q |
205 |
actaagtatacatgatcatatgtccgcttttctattgc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43825613 |
actaagtatacatgatcatatgtccgcttttctattgc |
43825650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 34519944 - 34519888
Alignment:
| Q |
2 |
atgatactttttaaatcggttaaactgatttcaaaattggtggaaccgatcttaaaa |
58 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
34519944 |
atgacactttttaaatcggttaaatcgatttaaaacgtggtggaaccgatcttaaaa |
34519888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 53
Target Start/End: Complemental strand, 28005270 - 28005224
Alignment:
| Q |
7 |
actttttaaatcggttaaactgatttcaaaattggtggaaccgatct |
53 |
Q |
| |
|
|||||||||||||||||||||||||| || | ||||| ||||||||| |
|
|
| T |
28005270 |
actttttaaatcggttaaactgatttaaacagtggtgaaaccgatct |
28005224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 53
Target Start/End: Complemental strand, 28062573 - 28062527
Alignment:
| Q |
7 |
actttttaaatcggttaaactgatttcaaaattggtggaaccgatct |
53 |
Q |
| |
|
|||||||||||||||||||||||||| || | ||||| ||||||||| |
|
|
| T |
28062573 |
actttttaaatcggttaaactgatttaaacagtggtgaaaccgatct |
28062527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University