View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_200 (Length: 248)
Name: NF6868A_low_200
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_200 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 22 - 236
Target Start/End: Complemental strand, 33717307 - 33717093
Alignment:
| Q |
22 |
caaatactgtgaagcctacctaacatctgcataagctatgacccaaccacggtccagaaggcttttaaattcactgcgccaccgtttgtcgagtagctca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33717307 |
caaatactgtgaagcctacctaacatctgcataagctatgacccaaccacggtccagaaggcttttaaattcactgcgccaccgtttgtcgagtagctca |
33717208 |
T |
|
| Q |
122 |
ccataagctccatgcccatgcaatattccaggtttttcatctttttgcttattgtcacgtgcaaaaacaacagtcaatggaatgagaaccccatcaaatg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33717207 |
ccataagctccatgcccatgcaatattccaggtttttcatctttttgcttattgtcacgtgcaaaaacaacagtcaatggaatgagaaccccatcaaatg |
33717108 |
T |
|
| Q |
222 |
aaggtacggcatatt |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33717107 |
aaggtacggcatatt |
33717093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University