View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_207 (Length: 247)
Name: NF6868A_low_207
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_207 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 247
Target Start/End: Complemental strand, 49471600 - 49471360
Alignment:
| Q |
7 |
gcaaatgaagtggttgttgcaactagcaaaacaagaggatcatgcttgaactttagctcccnnnnnnnnngtttttctcctaagtttttctcgaaagagg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49471600 |
gcaaatgaagtggttgttgcaactagcaaaacaagaggatcatgcttgaactttagctcccaaaaaaaaagtttttctcctaagtttttctcgaaagagg |
49471501 |
T |
|
| Q |
107 |
agctgcaaatgtagatgactgttttggatgtgtgctcaagttgggacactaatcaattccattgagttgttccagctcattggtaccctcaccaactttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49471500 |
agctgcaaatgtagatgactgttttggatgtgtgctcaagttgggacactaatcaattccattgagttgttccagctcattggtaccctcaccaactttt |
49471401 |
T |
|
| Q |
207 |
ttgcttttgattgctgcaaatccatctcatagcttatttga |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49471400 |
ttgcttttgattgctgcaaatccatctcatagcttatttga |
49471360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 2582487 - 2582433
Alignment:
| Q |
7 |
gcaaatgaagtggttgttgcaactagcaaaacaagaggatcatgcttgaacttta |
61 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| | |||||||| ||| ||||| |
|
|
| T |
2582487 |
gcaaatgaagttgttgttgcaactatcaaaacaatatgatcatgcctgatcttta |
2582433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University