View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_210 (Length: 246)
Name: NF6868A_low_210
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_210 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 34092619 - 34092374
Alignment:
| Q |
1 |
tcagttttttaactagcaattataattaatttaaaaaatcttttattgtaggcttgttaaagannnnnnnaaaaccaatattgatgttttaattaaattt |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
34092619 |
tcagttttttaacgagcaattataattaatttaaaaaatcttttattgtaggcttgttaaagatttttttaaaaccaattttgatgttttaattaaattt |
34092520 |
T |
|
| Q |
101 |
gaaagatattttnnnnnnncgatgttatgttaaagatgaaataaatattttgattaaccttgtattaaataatttttggtagaaaaaatagaaaacttag |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34092519 |
gaaagatattttaaaaaaacgatgttatgttaaagattaaataaatattttgattaaccttgtattaaataatttttggtagaaaaaatagaaaacttag |
34092420 |
T |
|
| Q |
201 |
tctgtatatgatgtgatttgttttcaaaggagattgtatatgatgt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34092419 |
tctgtatatgatgtgatttgttttcaaaggagattgtatatgatgt |
34092374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University