View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_211 (Length: 246)
Name: NF6868A_low_211
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_211 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 4 - 243
Target Start/End: Complemental strand, 9868088 - 9867849
Alignment:
| Q |
4 |
tcgaagaatataccacacacatcaaaccctatccttaattcaacatacaaaaattgctttggaacattggtgaaatataaagaagcgacgccagtctctc |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9868088 |
tcgaacaatataccacacacatcaaaccctttccttaattcaacatacaaaaattgctttggaacattggtgaaatataaggaagcgacgccagtctctc |
9867989 |
T |
|
| Q |
104 |
tttgatcatgatttcgtcatgcatcgtgaatatgatgattgagtcatatttgtttagccatgcatgactaaattccacgtgaataaaacttttctagaca |
203 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9867988 |
tttgatcatgatttcgccatgcatcgtgaatatgatgattgaatcatatttgtttagccatgcatgactaaattccacgttaataaaacttttctagatg |
9867889 |
T |
|
| Q |
204 |
gtgtgatccaattaccactaagatcgctactaaaggcaaa |
243 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9867888 |
gtgtgatccaattaccactacgatcgctactaaaggcaaa |
9867849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University