View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_216 (Length: 245)
Name: NF6868A_low_216
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_216 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 245
Target Start/End: Original strand, 46467367 - 46467604
Alignment:
| Q |
9 |
gattatactaaggagctgaatatggttggtggaatgaatctgatcatgtactggtgcgtgggacaagcgacatatggtctccatat-gtggtgtctctgc |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
46467367 |
gattgtactaaggagctgaatatggttggtggaatgaatctgatcatgtactggtgcgtgggacaagcgacatatggtctccattttgtggtgtctctgc |
46467466 |
T |
 |
| Q |
108 |
tagctgcaatcatttgttactgtccttgattgagtgtactaaggatttgtcttgaatattaattatgttcatgcataattatttggtgtccttgannnnn |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46467467 |
tagctgcaatcatttgttactgtccttgattgagtgtactaaggatttgacttgaatattaattatgttcatgcataattatttggtgtccttgattttt |
46467566 |
T |
 |
| Q |
208 |
nnagactttgatcctcctgagtgttgaagatcgtgtga |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46467567 |
ttagactttgatcctcctgagtgttgaagatcgtgtga |
46467604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University