View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_219 (Length: 244)
Name: NF6868A_low_219
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_219 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 12271700 - 12271473
Alignment:
| Q |
18 |
gacatcaattttatttatatggctacttcatatgactatgagccgcacttctctttatttttctatgttgcatgacgtgatttcaactacctgttatatg |
117 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12271700 |
gacatcaatttcttttatatggctagttcatatgactatgagccgcacttctctttatttttctatgttgcatgatgtgatttcaactacctgttatatg |
12271601 |
T |
 |
| Q |
118 |
ggattgttttttattctaagcaagatttaagctaagccatatcctaattctagtttgtttttt-cctctccatcactgtcgtttgtttaccgagaatgtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12271600 |
ggattgttttttattctaagcaagatttaaactaagctgtatcctaattctagtttgttttttccctctccatcactgtcgtttgtttaccgagaatgtt |
12271501 |
T |
 |
| Q |
217 |
cattgaatttatttctgaattctgtagg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
12271500 |
cattgaatttatttctgaattctgtagg |
12271473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University