View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6868A_low_225 (Length: 244)
Name: NF6868A_low_225
Description: NF6868A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6868A_low_225 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 224
Target Start/End: Original strand, 43804656 - 43804858
Alignment:
| Q |
22 |
tacttagagagcggagggtggtgcatcaggaaaatgggcaggctgctcgtctacaacagcctgttcagaatggtcaaacatggcagcgacacgtctattt |
121 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43804656 |
tacttagagagtggagggtggtgcatcaggaaaatggacaggctgctcgtctacaacagcctgttcagaatggtcaaacatggcagcgacacgtctattt |
43804755 |
T |
|
| Q |
122 |
ctgagcagcacaattagattggaattgagatttgcgtaagggacgcatatgaaatatttatgggagaaaaactttgtgggtgcaacctatcttgaatgtt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43804756 |
ctgagcagcacaattagattggaattgagatttgcttaagggacgcatatgaaatatttatgggagaaaaactttgtgggtgcaacctatcttgaatgtt |
43804855 |
T |
|
| Q |
222 |
aag |
224 |
Q |
| |
|
||| |
|
|
| T |
43804856 |
aag |
43804858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University